Skip to main content

Table 1 Characteristics and performance data of the primers used for reference gene-stability measure M and qPCR

From: Pharmacological doses of niacin stimulate the expression of genes involved in carnitine uptake and biosynthesis and improve the carnitine status of obese Zucker rats

Gene symbol Primer sequence (forward, reverse; from 5’ to 3’) NCBI GeneBank Product size (bp) Skeletal muscle Liver
Slope R2# Efficiency* Slope R2# Efficiency*
ACADL AAGGATTTATTAAGGGCAAGAAGC NM_012819.1 380 bp -4.45 1.000 1.68 -3.54 0.999 1.92
ACADM CAAGAGAGCCTGGGAACTTG NM_016986.2 154 bp -3.29 0.998 2.01 -3.29 0.998 2.01
ACADS ACATCTCTTCCCCACATCGC NM_022512.2 204 bp -2.98 0.999 2.16 -3.55 0.999 1.91
ACOX1 CTGGGCTGAAGGCTTTTACT NM_017340.2 172 bp -3.60 0.997 1.90 -3.97 0.999 1.79
ALDH9 TTGAGCGGCTGCGACACGAC NM_022273.2 82 bp   -   -3.42 0.999 1.96
ATP5B GCACCGTCAGAACTATTGCT NM_134364 203 bp -3.58 0.998 1.90 -3.33 0.999 2.00
BBOX1 GGATGGGGCTCGCTTGATGCA NM_022629.1 281 bp   -   -3.38 0.997 1.98
CANX CCAGATGCAGATCTGAAGAC NM_172008 175 bp -3.30 1.000 2.01 -3.45 0.999 1.95
MDH1 CAGACAAAGAAGAGGTTGCC NM_033235.1 206 bp -3.41 0.999 1.96 -3.27 0.999 2.02
RPL13 CTTAAATTGGCCACGCAGCT XR_086310 198 bp -3.20 0.999 2.05 -3.53 0.997 1.92
SLC22A5 GAACTCACGAGCCTCGCACGC NM_019269.1 117 bp -2.98 1.000 2.16 -3.51 1.000 1.93
TOP1 GAAGAACGCTATCCAGAAGG NM_022615 137 bp -3.45 0.999 1.95 -3.34 0.998 1.99
YWHAZ GACGGAAGGTGCTGAGAAA NM_013011 198 bp -3.11 0.999 2.10 -3.30 0.999 2.01
  1. #Coefficient of determination of the standard curve. *The efficiency was determined by [10-slope].