Skip to main content

Table 1 List of primers used in this study

From: Involvement of heat shock proteins on Mn-induced toxicity in Caenorhabditis elegans

Gene Seq 5' to 3'- Forward Seq 5' to 3' -Reverse
hsp-70 CCATGACTTAGTGGGACAAC AAGACTACGCCTTCCTACGT
pink1 TCATGTCTCGCTGAGCAACT GGCTCCATATCCGAATGCT
djr1.1 CTCGTGGTGAAATTCGTGTG GCGGACAAGTAGGCTTTCAG
pdr1 CAAATGTCTAGCCTGCAACG CGAACTATTGCACCCTGGAT
act1 ATCACCGCTCTTGCCCCATC GGCCGGACTCGTCGAATTCTTG