Skip to main content

Table 1 Real-time PCR primers

From: An inhibitor of 11-β hydroxysteroid dehydrogenase type 1 (PF915275) alleviates nonylphenol-induced hyperadrenalism and adiposity in rat and human cells

Gene Sequence (5′ to 3′ forward) Sequence (5′ to 3′ reverse)
11β-HSD1 CCTCCCCGTCCTGGTGCTCT TGCTCCGAGTTCAAGGCAGCG
GAPDH TGTGAACGGATTTGGCCGTA; GATGGTGATGGGTTTCCCGT
PPARα GCTCTGAACATTGGCGTTCG TCAGTCTTGGCTCGCCTCTA
(h) FASN CGCGT GGCCGGCTACTCCTAC CGGCTGCCACACGCTCCTCT
(h) PPARα CAGAACAAGGAGGCGGAGGTC TTCAGGTCCAAGTTTGCGAAGC
(h) PPARγ AGGCGAGGGCGATCTTGACAG GATGCGGATGGCCACCTCTTT
(h) 18 s rRNA TGCCATGTCTAAGTACGCACG TTGATAGGGCAGACGTTCGA