Skip to main content

Advertisement

Table 1 the sequences of PCR primers

From: Anti-hyperalgesic properties of a flavanone derivative Poncirin in acute and chronic inflammatory pain models in mice

Genes Forward primer Reverse prime
β-actin TGAAGGTCGGTGTGAACGGATTTGGC CATGTAGGCCATGAGGTCCACCAC
TNF-α GTTCTATGGCCCAGACCCTCA GGCACCACTAGTTGGTTGTCTTTG
IL-1β TCC AGG ATG AGG ACA TGA GCAC GAA CGT CAC CCA GCA GGT TA
IL-6 CCA CTT CAC AAG TCG GAG GCT TA CCA GTT TGG TAG CAT CCA TCA TTT C
VEGF TTACTGCTGTACCTCCACC ACAGGACGGCTTGAAGATG
Nrf2 TGG GGA ACC TGT GCT GAG TCA CTG GAG ACC CCT TGG ACA CGA CTC AGT GAC CTC
HO-1 CACGCATATACCCGCTACCT CCAGAGTGTTCATTCGAGA
SOD2 GCGGTCGTGTAAACCTCAT GGTGAGGGTGTCAGAGTGT