Skip to main content

Table 1 Sequence of RT-qPCR primers.

From: Simultaneous exposure to vinylcyclohexene and methylmercury in Drosophila melanogaster: biochemical and molecular analyses

Gene Left Right Flybase gene ID
Nrf2 (cap-n-collar) AGCGCATCTCGAACAAGTTT CGTGTTGTTACCCTCGGACT FBgn0262975
Keap1 CCAACTTCCTCAAGGAGCAG CGGCGACAAATATCATCCTT FBgn0038475
NF-κB activating protein-like CCGCAGAAACCAGAGAGTTC TGTGCTTTCTCTTGCCCTTT FBgn0039488
Jafrac1 TGGATCAACACGCCAAGGAA GGATGCCAGTCTCCTCATCG FBgn0040309
TrxR1 CGTTCTATTGTGCTGCGTGG AGCTTGCCATCATCCTGCTT FBgn0020653
Relish TTTAGGTGCGGCTCTGCTTT CTCTCCAGTTTGTGCCGACT FBgn0014018
GPDH ATGGAGATGATTCGCTTCGT GCTCCTCAATGGTTTTTCCA FBgn0001128
β-Tubulin ATCCCCAACAACGTGAAGAC ACCAATGCAAGAAAGCCTTG FBgn0284243