Skip to main content

Table 1 Sequence of RT-qPCR primers.

From: Simultaneous exposure to vinylcyclohexene and methylmercury in Drosophila melanogaster: biochemical and molecular analyses

GeneLeftRightFlybase gene ID
Nrf2 (cap-n-collar)AGCGCATCTCGAACAAGTTTCGTGTTGTTACCCTCGGACTFBgn0262975
Keap1CCAACTTCCTCAAGGAGCAGCGGCGACAAATATCATCCTTFBgn0038475
NF-κB activating protein-likeCCGCAGAAACCAGAGAGTTCTGTGCTTTCTCTTGCCCTTTFBgn0039488
Jafrac1TGGATCAACACGCCAAGGAAGGATGCCAGTCTCCTCATCGFBgn0040309
TrxR1CGTTCTATTGTGCTGCGTGGAGCTTGCCATCATCCTGCTTFBgn0020653
RelishTTTAGGTGCGGCTCTGCTTTCTCTCCAGTTTGTGCCGACTFBgn0014018
GPDHATGGAGATGATTCGCTTCGTGCTCCTCAATGGTTTTTCCAFBgn0001128
β-TubulinATCCCCAACAACGTGAAGACACCAATGCAAGAAAGCCTTGFBgn0284243