Skip to main content

Table 1 Primer sequences for six genes which chosen for gene expression analysis

From: Analysis of apoptosis related genes in nurses exposed to anti-neoplastic drugs

GeneSize of base pairsSequence of primer 5′ 3′
Bax155F: CCCGAGAGGTCTTTTTCCGAG
R: CCAGCCCATGATGGTTCTGAT
Bcl-289F: GGTGGGGTCATGTGTGTGTGG
R: CGGTTCAGGTACTCAGTCATCC
P53181F: GTCTGGGCTTCTTGCATT
R: GTCATGTGCTGTGACTGC
ACTB138F: AACGGTGAAGGTGACAGCAGTCG
R: GGCAAGGGACTTCCTGTAACAACG
Hif-1a164F: ACAGCCTCAGGAAACAGAGCAGG
R: CGCTTTCTCTGAGCATTTGCAAAGC
TopoIIa175F: GAATCAGATAGGAGCAGTGACG
R: GTGGACTAGCATCTGATGGGAC
TopoIIb182F: GCACTGACCTGGGTGAACAA
R: ACCCACATGAACTGCGTCAA