Skip to main content

Table 1 Primer sequences used in this study

From: Improved effect of a mitochondria-targeted antioxidant on hydrogen peroxide-induced oxidative stress in human retinal pigment epithelium cells

Target gene Forward sequence (5′-3′) Reverse sequence (5′-3′)
ATP5O CGCTATGCCACAGCTCTTTA AAGGCAGAAACGACTCCTTG
COX4I1 GGCATTGAAGGAGAAGGAGA TCATGTCCAGCATCCTCTTG
COX5B GAGGTGGTGTTCCCACTGAT CAGACGACGCTGGTATTGTC
NDUFB5 CTTCCTCACTCGTGGCTTTC TCTGGGACATAGCCTTCTGG
FIS1 GACATCCGTAAAGGCATCGT ACAGCAAGTCCGATGAGTCC
MFN1 TGCCCTCTTGAGAGATGACC TCTTTCCATGTGCTGTCTGC
MFN2 ATGCATCCCCACTTAAGCAC GCAGAACTTTGTCCCAGAGC
TFAM TAAGACTGCAAGCAGCGAAG TTCTCAGTTTCCCAGGTGCT
POLG TGCAGTGAGGAGGAGGAGTT CCCAGGTAAGTGCCATGAGT
SOD1 GAAGGTGTGGGGAAGCATTA CTTTGCCCAAGTCATCTGCT
SOD2 AAACCTCAGCCCTAACGGTG GCCTGTTGTTCCTTGCAGTG
CAT GATAGCCTTCGACCCAAGCA AGAAGGCTGTTGTTCCGGAG
GPX1 AGTCGGTGTATGCCTTCTCG CAAACTGGTTGCACGGGAAG
TXN2 TGGTGGCCTGACTGTAACAC CACCGCTGACACCTCATACT
PRDX3 TGCATGTGGAAGAACGAGCT TCCACTGAGACTGCGACAAC
PRDX5 AGGGTGTGCTGTTTGGAGTT TCCACATTCAGGGCCTTCAC
PRDX6 CAGCTCGTGTGGTGTTTGTT AGATGGGAGCTCTTTGGTGA
HMOX1 AGTCTTCGCCCCTGTCTACT GCTTGAACTTGGTGGCACTG
NQO1 AAAGGACCCTTCCGGAGTAA CGTTTCTTCCATCCTTCCAG
PGC1a CAAGCAAAGGGAGAGGCAGA ACCTGCGCAAAGTGTATCCA
PGC1b TGGGCTGAGTTCTCCATTCT TGAAGCTGCGATCCTTACCT
ESRRA TCGCTGTCTGACCAGATGTC AGGGCCAAGGCCTTTAGTAG
FOXO1 GCATCCATGGACAACAACAG AGATGGCGGGTACACCATAG
FOXO3 CATCATGGCAAGCACAGAGT GAGCGTGATGTTATCCAGCA
NRF1 CTTACAAGGTGGGGGACAGA CAATGTCACCACCTCCACAG
NRF2 GCGACGGAAAGAGTATGAGC ACGTAGCCGAAGAAACCTCA
PPARA CCCTTTTTGTGGCTGCTATC ATCCGACTCCGTCTTCTTGA
SIRT1 CCATGGCGCTGAGGTATATT TCTCCATCAGTCCCAAATCC
GAPDH ACCCAGAAGACTGTGGATGG TTCTAGACGGCAGGTCAGGT