Skip to main content

Table 1 The primers used for quantitative real time PCR (qRT-PCR)

From: Impact of Lesinurad and allopurinol on experimental Hyperuricemia in mice: biochemical, molecular and Immunohistochemical study

GeneProduct size (bp)Accession numberDirectionSequence (5′-3′)
mOAT-1183NM_008766.3SenseGACAGGGTCTCATCCCTAGC
AntisenseGTCCCTGACACACTGACTGA
mOAT-3153NM_001164635.1SenseTACAGTTGTCCGTGTCTGCT
AntisenseCTTCCTCCTTCTTGCCGTTG
mURAT-1145NM_009203.3SenseGATAGGTTTGGGCGCAGAAG
AntisenseTCATCATGACACCTGCCACT
mGlut-9153NM_001102415.1SenseTTCGGGTCCTTCCTTCCTCTA
AntisenseGGACACAGTCACAGACCAGA
mβ-actin143Nm_007393.5SenseCCAGCCTTCCTTCTTGGGTA
AntisenseCAATGCCTGGGTACATGGTG