Skip to main content

Table 1 Primer sequences for RT-PCR reaction

From: New uracil analog U-332 is an inhibitor of NF-κB in 5-fluorouracil-resistant human leukemia HL-60 cell line

GenePrimer sequences
Forward primerReverse primer
GAPDHGTCGCTGTTGAAGTCAGAGGAGCGTGTCAGTGGTGGACCTGAC
RelACGGGATGGCTTCTATGAGGCTCCAGGTCCCGCTTCTT
RelBGGCCTGGGAGAAGTCAGCGCTCTACTTGCTCTGCGACA
c-RelTGAACATGGTAATTTGACGACTGACACGACAAATCCTTAATTCTGC
NF-κB1ACCCTGACCTTGCCTATTTGAGCTCTTTTTCCCGATCTCC
NF-κB2GAACTCCTCCATTGTGGAACCGAACTCCTCCATTGTGGAACC