Skip to main content

Table 1 Sequences of primers in RT-PCR

From: Isoniazid causes heart looping disorder in zebrafish embryos by the induction of oxidative stress

Target Gene Primer Sequences
18 s Forward:5’TCGCTAGTTGGCATCGTTTATG 3′
Reverse:5′ CGGAGGTTCGAAGACGATCA 3’
Amhc Forward:5’ AAGGTAAAATCCTACAAACGTTCGG 3′
Reverse:5′ CAAACAAATCAAAGTGCGATTGCAC 3’
cTNT Forward:5’ GTCTGCACTTCGGCGGTTACA 3′
Reverse:5’AGGTAAAATCTATATTGTTCAGTGAAATCTAACCG3’
Vmhc Forward:5′ ACATAGCCCGTCTTCAGGATTTGG 3′
Reverse:5′ GAGAGAAAGGCAAGCAAGTACTGG 3’
Cmlc2 Forward:5’ AGACCCAGAGGAAACCATCC 3′
Reverse:5′ TTGGGTCATTAGCAGCCTCT 3’
Tbx5 Forward:5’CGCTATAAATTCGCCGATAACAA 3′
Reverse:5′ AGACACCAGTTGCCTCATCCAG3’
Hand2 Forward:5’ GGACATTCTGGACAAAGATGAA 3′
Reverse:5′ GCCAACCAGTTCTCCCTTTA 3’
Gata4 Forward:5’ CCAGACACACACCAGCTCTACAC 3′
Reverse:5′ ATCAGGCTGTTCCACACTTCACT 3’