Skip to main content

Table 1 Sequences of primers in RT-PCR

From: Isoniazid causes heart looping disorder in zebrafish embryos by the induction of oxidative stress

Target GenePrimer Sequences
18 sForward:5’TCGCTAGTTGGCATCGTTTATG 3′
Reverse:5′ CGGAGGTTCGAAGACGATCA 3’
AmhcForward:5’ AAGGTAAAATCCTACAAACGTTCGG 3′
Reverse:5′ CAAACAAATCAAAGTGCGATTGCAC 3’
cTNTForward:5’ GTCTGCACTTCGGCGGTTACA 3′
Reverse:5’AGGTAAAATCTATATTGTTCAGTGAAATCTAACCG3’
VmhcForward:5′ ACATAGCCCGTCTTCAGGATTTGG 3′
Reverse:5′ GAGAGAAAGGCAAGCAAGTACTGG 3’
Cmlc2Forward:5’ AGACCCAGAGGAAACCATCC 3′
Reverse:5′ TTGGGTCATTAGCAGCCTCT 3’
Tbx5Forward:5’CGCTATAAATTCGCCGATAACAA 3′
Reverse:5′ AGACACCAGTTGCCTCATCCAG3’
Hand2Forward:5’ GGACATTCTGGACAAAGATGAA 3′
Reverse:5′ GCCAACCAGTTCTCCCTTTA 3’
Gata4Forward:5’ CCAGACACACACCAGCTCTACAC 3′
Reverse:5′ ATCAGGCTGTTCCACACTTCACT 3’