Skip to main content

Table 2 Primers sequence

From: Transcriptome investigation of anti‐inflammation and immuno‐regulation mechanism of taurochenodeoxycholic acid

Gene name Sequence (5′ → 3′)
SRSF9 Forward: ATTTGGTGTCATCCAGTTTCC
Reverse: CAGATTTCCGAGTTCTTGTTTC
GPX3 Forward: GGTGTTGTACCAAACCGTGAG
Reverse: ATCCCAGATTCCCTTCCTTAT
CSTB Forward: GGAAAGAAACAAAATACAACG
Reverse: TACCAGACCGACAAAGAAAAG
CTGF Forward: AGTTCGTGTCCCTTACTCCCT
Reverse: AAGACCTGTGCCTGCCATTAC
GAPDH Forward: TCACCCCATTTGATGTTAGCG
Reverse: GCAAGTTCAACGGCACAGTCA
β-actin Forward: GGAGATTACTGCCCTGGCTCCTA
Reverse: GACTCATCGTACTCCTGCTTGCTG