Skip to main content

Table 1 Summary of PCR primer pairs

From: The cytotoxicity and apoptotic effects of verbascoside on breast cancer 4T1 cell line

Name Sequence of primers Annealing Temperature
Bax Forward: 5’CAAGGCCCTGTGCACTAAAGT3’ 60 °C
Reverse: 5’AAGTAGGAGAGGAGGCCTTCC3’
Bcl2 Forward: 5’GGAGAAATCAAACAGAGGTCGC3’ 60 °C
Reverse: 5’CGTCAACAGGGAGATGTCACC3’
MyD88 Forward: 5’CTCCAGGTGTCCAACAGAAGC3’ 60 °C
Reverse: 5’TCATCTTCCCCTCTGCCCTAG3’
NF-κB Forward: 5’GCCATTGAAGTGATCCAGGCA3’ 60 °C
Reverse: 5’TCCCGGAGTTCATCTATGTGCT3’
TLR4 Forward 5’GCATGGATCAGAAAACTCAGC −5’ 60 °C
Reverse: 5’TGTTTCAATTTCACACCTGGA −5’
Caspase 3 Forward: 5’GGAGCAGCTTTGTGTGTGTG3’ 60 °C
Reverse: 5’TCCAGGAATAGTAACCAGGTGC3’
GAPDH Forward: 5’GGAAGGTGAAGGTCGGAGTCA3’ 60 °C
Reverse: 5’GTCATTGATGGCAACAATATCCACT3’