Skip to main content

Table 1 Primers sequences used in qPCR experiments

From: Silibinin attenuates adipose tissue inflammation and reverses obesity and its complications in diet-induced obesity model in mice

GeneForward primerReverse primer
AccATGGGCGGAATGGTCTCTTTCTGGGGACCTTGTCTTCATCAT
AdiponectinTGTTCCTCTTAATCCTGCCCACCAACCTGCACAAGTTCCCTT
Cd11cCTGGATAGCCTTTCTTCTGCTGGCACACTGTGTCCGAACTCA
Cd36ATGGGCTGTGATCGGAACTGGTCTTCCCAATAAGCATGTCTCC
F4/80TGACTCACCTTGTGGTCCTAACTTCCCAGAATCCAGTCTTTCC
FasGGAGGTGGTGATAGCCGGTATTGGGTAATCCATAGAGCCCAG
GadphAGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA
Il-10GCTCTTACTGACTGGCATGAGCGCAGCTCTAGGAGCATGTG
Il-1βGCAACTGTTCCTGAACTCAACTATCTTTTGGGGTCCGTCAACT
Il-6TAGTCCTTCCTACCCCAATTTCCTTGGTCCTTAGCCACTCCTTC
LeptinGAGACCCCTGTGTCGGTTCCTGCGTGTGTGAAATGTCATTG
Srebp1cGCAGCCACCATCTAGCCTGCAGCAGTGAGTCTGCCTTGAT
Tnf-αCCCTCACACTCAGATCATCTTCTGCTACGACGTGGGCTACAG