Tongue squamous cell carcinoma (SCC-9 ATCC CRL-1629) cells and HUVEC (ATCC CRL-1730) were purchased from American Type Culture Collection (ATCC, USA). Nude mice were purchased from the Institute of Chinese Academy of Medical Sciences and maintained under a 12:12 h light-dark cycle at 20–25 °C. All animal work and experimental protocols were approved by the Ethics Committee for Animal Experiments of the China Medical University, strictly complying with the institutional guidelines and criteria outlined in the “Guide for Care and Use of Laboratory Animals”.
Lentiviral vector construction
The lentiviral expression plasmid GV287 and packaging plasmids (Helper 1.0 and Helper 2.0) were purchased from Genechem (Shanghai, China). This system belongs to the third generation of lentiviral vector. The GV287 vector contains the basic components of HIV 5’LTR and 3’LTR as well as other secondary auxiliary elements. The Helper1.0 vector contains the gag gene of the HIV virus, which encodes the major structural protein of the virus; the pol gene, which encodes virus-specific enzyme; and the rev gene, which encodes the genes that regulate the expression of gag and pol gene. The Helper 2.0 vector contains the VSV-G gene from the herpes simplex virus, which provides the envelope protein required for viral packaging. The Sema3A gene was cloned and amplified using polymerase chain reaction (PCR) with the following primers: GAGGATCCCCGGGTACCGGTCGCCACCATGGGCTGGTTAACTAGGATTGTCTG and TCCTTGTAGTCCATACCGACACTCCTGGGTGCCCTCTCAAATTC; then, the gene was inserted into the AgeI site of GV287 to generate pGV287Sema3A. The pGV287Sema3A was transformed into E.coli, and the right clones were proved by PCR with the specific primers: AAATGGAGACCCACTGAC and CGTCGCCGTCCAGCTCGACCAG Recombinant lentiviral vectors were produced by co-transfecting 293 T cells with the lentiviral expression plasmid pGV287Sema3A and the packaging plasmids (Helper 1.0 and Helper 2.0). A total of 293 T cells (6 × 105) were cultured in a 10 cm tissue culture plate with opti-MEM (GIBCO, USA). Transfection was performed when cell density reached 30–40% confluency. Plasmid GV287Sema3A and the packaging plasmids were co-transfected into 293 T cells using Lipofectamine 2000 according to the manufacturer’s instructions. 293 T cells were cultured routinely. After 6 h of culture, the medium was replaced by DMEM (GIBCO, USA). Infectious lentiviruses were harvested at 48 h post-transfection and concentrated. The viral titer was determined by the dilution gradient method and calculated as follows: virus titer (TU/ml) = (counted fluorescent cells/corresponding dilution time) × 100. Virus vectors were stored at −80 °C until use.
In vitro lentiviral transduction
At 70% confluency, SCC-9 cells were infected with Lenti Sema3A-EGFP at 40 MOI. After 48 h, transduction efficiency was assessed by fluorescent microscopy. The expression of Sema3A in SCC-9 cells was detected after 48 h of transfection with LentiSema3A-EGFP by Western blot.
Western blot
SCC-9 cells or tumor tissues were washed twice with cold PBS and resuspended in cold lysis buffer containing 20 mmol/L HEPES (pH 7.5), 150 mmol/L NaCl, 1 mmol/L EDTA, 0.5% Triton X-100, and protease inhibitors (Roche). Similar quantities of total protein (20 μg) were separated by SDS-PAGE, transferred onto nitrocellulose membranes, and blocked overnight in blocking solution at 4 °C. For Sema3A detection, the membranes were incubated for 1 h with anti-human Sema3A monoclonal antibodies (Santa Cruz Biotechnology), followed by anti-mouse secondary antibody conjugated to horseradish peroxidase (Zymed, Inc., South San Francisco, CA) for 1 h at room temperature. For the detection of phosphorylated VEGFR2, Src, and FAK, the membranes were incubated for 1 h with mouse monoclonal antibodies raised against human p-VEGFR2 (Invitrogen), p-Src (Invitrogen), and p-FAK (Cell Signaling), respectively, followed by anti-mouse or anti-rabbit secondary antibodies conjugated to horseradish peroxidase (Zymed, Inc., South San Francisco, CA) for 1 h at room temperature. The enhanced chemiluminescence ECL Plus system (Amersham Biosciences UK, Little Chalfont, UK) was used to reveal the signals. Beta-actin was used as an internal control.
Tube formation assay
Tube formation assay was performed on growth factor reduced matrigel coated plates. Briefly, 250 μl cold matrigel was coated on 24 well plates, and incubated at 37 °C for 1 h for polymerization. Then, 105 endothelial cells were treated with PBS, VEGF (40 μg/mL), Sema3A (50 μg/mL) and Sema3A (50 μg/mL) plus VEGF (40 μg/mL), and grown on matrigel coated plates at 37 °C with serum stavation. In addition, 105 endothelial cells were also cultured in the matrigel with starvation medium from cultured SSC-9 with or without Sema3A overexpression. The Tubule structure was photographed 24 h after cell seeding by microscopy. Vascular cross points were counted in five randomly selected fields under a microscope in a blinded manner.
Chick chorioallantoic membrane angiogenesis assay
Ten-day-old pathogen-free chick embryos were used for angiogenesis assays as previously described [20]. Briefly, 6 mm round filters were treated with PBS, VEGF165 (40 μg/mL), Sema3A (50 μg/mL) and Sema3A (50 μg/mL) plus VEGF165 (40 μg/mL). After the establishment of CAM, a filter was placed onto the non-vessel area of CAM. After 72 h of incubation, CAMs were harvested, and vascular density count was performed. Angiogenesis was quantified by counting the branch points arising from the tertiary vessels in a 6-mm-square area where the filter carrying the recombinant angiogenic factors was added. To count vessels, CAMs were photographed using a research stereoscope (model SZH10; Olympus, Melville, NY) equipped with a SPOT camera (model 2.2.1; Diagnostic Instruments, Sterling Heights, MI). PBS vessel count was subtracted as background.
Animal model of tumor xenografts
Nude mice (male, 20-25 g) were used in this study. Tumor xenografts were generated by subcutaneous injection of 1 × 106 cells into the flank of 6 week old BALB/cANNCjr nu/nu mice. Animals were monitored for 8 weeks, and sacrificed with high dose pentobarbital sodium (75 mg/kg). Tumors were harvested and weighted, and tumor dimensions were measured with calipers, and tumor volumes calculated using the simplified formula for a rotational ellipsoid: 0.4 × length2 × width.
Capillary density measurement in oral cancer tissue samples
Tumors were harvested and snap-frozen in liquid nitrogen. Cryosections of 10 μm were prepared. Then, endothelial cells were stained with monoclonal anti-CD31 primary antibody (Pharmingen), followed by biotinylated anti-mouse IgG secondary antibody, and an avidin-HRP conjugate for color reaction (DAB paraffin IHC staining module, Ventana Medical Systems, Inc., Tucson, AZ). The sections were analyzed by microscopy, with 5 high power fields randomly selected in each section; CD31-positive cells were counted in a blinded manner. The number of CD 31-positive cells in each field was used as an index of capillary density.
Statistical analysis
Data are mean ± standard deviation (SD). Student t-tests were performed to confirm significance of pairwise comparisons of vector control versus Sema 3A expressing cells. The other statistical comparisons were performed using ANOVA followed by Bonferroni/Dunn tests. P < 0.05 was considered statistically significant.
